Plasmid
Part:BBa_K747098
Designed by: Lucas Schneider Group: iGEM12_Freiburg (2012-09-26)
MammoBrick
Since we wanted to express our protein in Human Embryonic Kidney (HEK) cells, we needed a eukaryotic expression vector. Unfortunately, the registry does not offer such a vector, so we decided to build one our own. In order to avoid intellectual property rights violations, we ordered the vector [http://www.everyvector.com/sequences/show_public/18260 pTALEN_(v2)_NG] (along with the Zhang Lab TALE Toolbox) from the open source plasmid repository Addgene. The Zhang Lab at MIT has constructed this plasmid for TAL effector expression, so we decided that it would be a good template for our own vector. Converting pTALEN (v2) NG into a RFC 10 compatible vector would have taken more mutagenesis PCRs than we would be able to perform over the summer, so we chose the following assembly strategy:
In the first step, we wanted to built a universal mammalian expression vector (called MammoBrick), which would allows future iGEM students to express any gene in human cell lines simply by cloning the open reading frame into the MammoBrick using the BioBrick assembly protocol. We assembled the MammoBrick from the following four parts:
Part 1: BACKBONE:
We have cut the backbone out of pTALEN (v2) NG with Ngo MIV and AfiII and purified the corresponding 2234bp band from a gel. Since both enzymes produce 5’ overhangs, they were compatible with overhangs produced by BsaI digestion. This backbone contains a SV 40 polyadenylation signal, an ampicillin resistance gene and an origin of replication.
Part2: CMV promoter:
At first, we tried to use the CMV promotor that was included in the 2012 distribution kit. Part BBa_J52034 was submitted to the registry by Team Slovenia in 2006 and has been on the distribution kit since then (although sequencing was inconsistent every year). After numerous attempts to use this part, we sequenced it and found out that it was not a CMV promotor, but a part of the lacI gene. Reading the part’s review, we noticed that Team Munich 2010 had already pointed out that it was a lacI fragment. Interestingly, Team DTU Denmark was able to induce fluorescent protein expression with this bacterial gene fragment- magic. Since no other mammalian promoter was available on this year’s distribution kit, we designed the following primers and amplified the CMV promoter from the vector pPhi-Yellow-C:
GTTACCGGTCTCGTTAAGAATTCGCGGCCGCTTCTAGAGATAGTAATCAATTACGGGGTC
CTAGAGGTCTCGCTGCCTGCAGCGGCCGCTACTAGTAGATCTGACGGTTCACTAAAC
After incorporation of these primers into the CMV promoter, amplification product, the promoter is not only flanked by the iGEM prefix and suffix, but also by distal BsaI restriction sites. This way, we were able to directly assemble the PCR product with the other MammoBrick parts.
Part 3: PuroORF:
We replaced the hygromycin resistance gene in pTALEN (v2) NG for two reasons: Firstly, it contained multiple RFC 10 restriction sites and secondly, selection via hygromycin takes much longer than selection with puromycin. Since we also didn’t find a puromycin ORF without illegal restriction sites, we decided to make silent mutations in the PuroORF to remove these sites and get it synthesized, flanked by BsaI restriction sites and appropriate overlaps for subsequent golden gate cloning.
Part 4: PostORF:
We called the region between the stop codon of the TAL ORF and the start codon of the antibiotic resistance gene PostORF. We wanted to use this part in our vector because it contains the SV40 promoter and enhancer for expression of the antibiotic selection marker. So we used PCR to “excise the fragment and add BsaI sites and appropriate overlaps to it.
After every single part had been purified, we used Golden Gate cloning to assemble them in one step. After quite some testing, we came up with the following protocol:
In the first step, we wanted to built a universal mammalian expression vector (called MammoBrick), which would allows future iGEM students to express any gene in human cell lines simply by cloning the open reading frame into the MammoBrick using the BioBrick assembly protocol. We assembled the MammoBrick from the following four parts:
Part 1: BACKBONE:
We have cut the backbone out of pTALEN (v2) NG with Ngo MIV and AfiII and purified the corresponding 2234bp band from a gel. Since both enzymes produce 5’ overhangs, they were compatible with overhangs produced by BsaI digestion. This backbone contains a SV 40 polyadenylation signal, an ampicillin resistance gene and an origin of replication.
Part2: CMV promoter:
At first, we tried to use the CMV promotor that was included in the 2012 distribution kit. Part BBa_J52034 was submitted to the registry by Team Slovenia in 2006 and has been on the distribution kit since then (although sequencing was inconsistent every year). After numerous attempts to use this part, we sequenced it and found out that it was not a CMV promotor, but a part of the lacI gene. Reading the part’s review, we noticed that Team Munich 2010 had already pointed out that it was a lacI fragment. Interestingly, Team DTU Denmark was able to induce fluorescent protein expression with this bacterial gene fragment- magic. Since no other mammalian promoter was available on this year’s distribution kit, we designed the following primers and amplified the CMV promoter from the vector pPhi-Yellow-C:
GTTACCGGTCTCGTTAAGAATTCGCGGCCGCTTCTAGAGATAGTAATCAATTACGGGGTC
CTAGAGGTCTCGCTGCCTGCAGCGGCCGCTACTAGTAGATCTGACGGTTCACTAAAC
After incorporation of these primers into the CMV promoter, amplification product, the promoter is not only flanked by the iGEM prefix and suffix, but also by distal BsaI restriction sites. This way, we were able to directly assemble the PCR product with the other MammoBrick parts.
Part 3: PuroORF:
We replaced the hygromycin resistance gene in pTALEN (v2) NG for two reasons: Firstly, it contained multiple RFC 10 restriction sites and secondly, selection via hygromycin takes much longer than selection with puromycin. Since we also didn’t find a puromycin ORF without illegal restriction sites, we decided to make silent mutations in the PuroORF to remove these sites and get it synthesized, flanked by BsaI restriction sites and appropriate overlaps for subsequent golden gate cloning.
Part 4: PostORF:
We called the region between the stop codon of the TAL ORF and the start codon of the antibiotic resistance gene PostORF. We wanted to use this part in our vector because it contains the SV40 promoter and enhancer for expression of the antibiotic selection marker. So we used PCR to “excise the fragment and add BsaI sites and appropriate overlaps to it.
After every single part had been purified, we used Golden Gate cloning to assemble them in one step. After quite some testing, we came up with the following protocol:
| Component | Amount (μl) |
|---|---|
| pTALEN (v2) NG backbone (56 ng) | 1 |
| CMV promoter (17 ng) | 1 |
| Post ORF (17,5 ng) | 1 |
| ddH2O | 11,5 |
| T4 Ligase (400 U) | 1 |
| BsaI (15 U) | 1 |
| T4 Ligase buffer | 2 |
| Total | 20 |
| Thermocycler programm: |
|---|
| 1. 37°C, 5 min |
| 2. 20 °C, 5 min |
| go to 1. 50 times |
| 4. 50°C, 10 min |
| 5. 80°C, 10 min |
So we assembled the whole MammoBrick vector in one single reaction:
Sequence and Features
Assembly Compatibility:
- 10INCOMPATIBLE WITH RFC[10]Illegal prefix found in sequence at 966
Illegal suffix found in sequence at 1568 - 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 966
Illegal SpeI site found at 1569
Illegal PstI site found at 1583
Illegal NotI site found at 972
Illegal NotI site found at 1576 - 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 966
Illegal BglII site found at 1563 - 23INCOMPATIBLE WITH RFC[23]Illegal prefix found in sequence at 966
Illegal suffix found in sequence at 1569 - 25INCOMPATIBLE WITH RFC[25]Illegal prefix found in sequence at 966
Illegal XbaI site found at 981
Illegal SpeI site found at 1569
Illegal PstI site found at 1583 - 1000COMPATIBLE WITH RFC[1000]
[edit]
Categories
Parameters
| None |